1. Welcome! Please take a few seconds to create your free account to post threads, make some friends, remove a few ads while surfing and much more. ClutchFans has been bringing fans together to talk Houston Sports since 1996. Join us!

Scientists Reconstruct Neanderthal DNA

Discussion in 'BBS Hangout' started by rimrocker, Nov 15, 2006.

  1. rimrocker

    rimrocker Member

    Joined:
    Dec 22, 1999
    Messages:
    24,534
    Likes Received:
    13,782
    Science marches on...
    __________

    Scientists Reconstruct Portion of Neanderthal DNA
    Finding Could Help Researchers Learn More About Early Humans

    By Rick Weiss
    Washington Post Staff Writer
    Wednesday, November 15, 2006; 2:46 PM

    Scientists said today that by unleashing a new kind of DNA analyzer on a 38,000-year-old fragment of fossilized Neanderthal bone they had reconstructed a portion of that creature's genetic code -- a technological tour de force that has researchers convinced they will soon know the entire DNA sequence of the closest cousin humans ever had.

    Such a feat, unanticipated even a few years ago, could tell a lot about what Neanderthals were like, from their hair and skin color to their relative facility with language. It could also clear up what sort of relationship existed between them and the first modern humans -- including whether the two tribes continued to interbreed after they diverged onto separate evolutionary trajectories.

    Perhaps most tantalizing, the newfound capacity to reconstruct prehistoric DNA should allow scientists to home in on the less than one-half of one percent of the human genome that is expected to be different from that of Neanderthals, who went extinct 30,000 years ago.

    Those differences, scientists said, essentially spell out in biological terms what makes humans human.

    The new findings, by research teams in Germany and California, "are perhaps the most significant contributions published in this field since the discovery of Neanderthals 150 years ago," wrote David M. Lambert and Craig D. Millar in a commentary in the journal Nature, which along with the journal Science is publishing the work this week. Lambert and Millar, who were not involved in the work, are both experts in molecular evolution at universities in New Zealand.

    "Personally I was blown away when I first heard wind of this," said Sean B. Carroll, a Howard Hughes Medical Institute investigator and evolutionary geneticist at the University of Wisconsin at Madison. "We're all kind of giddy with excitement."

    As the most closely related and recently departed members of the human family tree -- and as the widely recognized, boney browed icons of stonier times -- Neanderthals have long fascinated scientists and armchair paleo-anthropologists alike. They and their counterparts -- our human forebears -- started as equals hundreds of thousands of years back, but took very different paths.

    One line went on to develop all that human culture is today, from haute couture to DNA synthesizers. The other, while not as primitive as often made out to be, mysteriously disappeared in a wave of die-outs that started in Western Asia about 45,000 years ago and ended with their extinction in Europe about 15,000 years later.

    Some say climate change did them in. Some blame the modern humans who were expanding throughout Europe at the time and who, thanks apparently to some fortuitous genetic mutations, were enjoying an intellectual and socio-cultural awakening.

    The quest to understand Neanderthals on the level of molecular genetics was for a long time seen as hopeless. DNA, which holds the instructions for life that are contained in virtually every living cell, breaks down with time.

    A few researchers -- most notably Svante Paabo of the Max Planck Institute for Evolutionary Anthropology in Liepzig, Germany -- have managed to extract DNA fragments from 5,000-year-old Egyptian mummies, and even stitch a few together in proper sequence. But the DNA pieces from much older specimens are so small that no technology could put them all together again with any semblance of accuracy.

    Complicating matters further, prehistoric bones are heavily contaminated with the DNA from bacteria, as well as with modern human DNA from the scientists who discovered and handled them. That is one reason why no extinct animal has ever had its genome fully sequenced.

    But the technology for detecting, analyzing and reconstructing disintegrated DNA has evolved at a stunning rate. As part of an ongoing, ambitious effort to catalogue every life form on Earth, companies have developed machines that can tell whether a snippet of DNA came from the same organism as another snippet -- and if so, whether the two DNA fragments were once attached to one another. Stitch by stitch, an organism's genome, or complete genetic code, can quickly come into view.

    To do so with Neanderthal DNA, Paabo and his colleagues first tested more than 70 Neanderthal tooth and bone samples to see which had the smallest proportion of contaminating DNA. (Some 300 partial skeletal remains are known worldwide, their preservation and discovery aided by the Neanderthals' tradition of burying their dead.)

    One bone, which had been discovered decades ago in the Vindija Cave in Croatia, stood out for its relatively pristine condition. Although more than 90 percent of the detectable DNA was from bacteria, virtually all of the rest appeared to be Neanderthal, recognizable by its similarity to human DNA but with occasional stretches reminiscent of chimpanzee patterns.

    It had remained relatively clean, Paabo said, because "it's rather small and uninteresting and was thrown in a big box of 'uninformative' bones and was not handled much by people."

    Having picked his bone, Paabo's team turned to 454 Life Sciences of Branford, Conn. The company is developing high-speed DNA analyzers with the goal of being able to offer patients -- or better yet, people who are not yet patients -- affordable, personalized, analyses of their own genomes.

    In a test run on 20 grams of pulverized bone, the analyzer determined the proper order of about one million "letters" -- or "bases" -- of Neanderthal genetic code, Paabo and his colleagues report in the Nov. 16 Nature.

    Assuming that Neanderthals, like humans, have about 3 billion bases in their code, that's less than one-thousandth of the entire Neanderthal genome. But with a full bore effort now underway, the cracking of the Neanderthal code will be complete in about 18 months, Paabo said.

    "Clearly, we are at the dawn of Neanderthal genomics," said Edward M. Rubin of the Department of Energy's Joint Genome Institute in Walnut Creek, Calif., and the Lawrence Berkeley National Laboratory. Rubin was the leader of a second team that used a different method to sequence more than 65,000 Neanderthal bases from the same bone -- landmark work described in Friday's issue of Science.

    "We're going to be able to learn about their biology, learn things we could never learn from the bones or the artifacts," Rubin said. "This data will serve as a DNA time machine."

    Scientists have already identified a few fortuitous genetic glitches they suspect may have helped launch humans to global dominance even as our beetle-browed sidekicks got mired in an evolutionary dead end. One of those mutations, in a gene called FOXP2, may have facilitated language. Another by the name microcephalin may have been a driving force behind the big increase in brain size that occurred in humans.

    Until now, the only Neanderthal DNA that had given up its secrets to scientists were bits of so-called mitochondrial DNA, which is of limited value because it does not contain genes involved in physical appearance, intelligence, or language. Moreover, mitochondrial DNA is inherited only from a person's mother, so reveals nothing about traits inherited from a father.

    The new reports confirm several preliminary findings from the mitochondrial studies -- that modern humans and Neanderthals split into genetically distinct populations around half a million years ago, for example. They also contain no evidence of interbreeding between early humans and Neanderthals, though a final answer to that question must await a more detailed analysis.

    But the real excitement is about what the new technology is about to reveal, scientists said.

    "Having a Neanderthal genome will throw light on our own evolution, by allowing a three-way comparison of the genetic blueprints that produced Neanderthals and that today produce us and our closest living relatives, the chimpanzees," said Chris Stringer, human origins research leader at London's Natural History Museum.

    "We should then be able to pin down unique changes in each genome to show how we came to be different from each other."

    http://www.washingtonpost.com/wp-dyn/content/article/2006/11/15/AR2006111501042_pf.html
     
  2. A-Train

    A-Train Member

    Joined:
    Jan 1, 2000
    Messages:
    15,997
    Likes Received:
    39
    Why exactly do they need to RECONSTRUCT Neanderthal DNA?

    [​IMG]

    C'mon...you knew SOMEBODY was going to say it...
     
  3. JayZ750

    JayZ750 Member

    Joined:
    May 16, 2000
    Messages:
    25,432
    Likes Received:
    13,390
    If there was Neanderthal / Human interbreeding, it might have produced Kaman. If you want 100% Neanderthal, your best living bet is obvious:

    [​IMG]

    Seriously, though, that is one cool article. The part about working to map the DNA of every living creature reminds of the end of the movie Mission to Mars.
     
  4. Saint Louis

    Saint Louis Member

    Joined:
    Jun 27, 1999
    Messages:
    4,260
    Likes Received:
    0
    They can be house broken though

    [​IMG]
     
  5. finalsbound

    finalsbound Member

    Joined:
    Aug 31, 2000
    Messages:
    12,337
    Likes Received:
    930
    [​IMG]

    Jesus, Dirk is ****ing scary looking.
     
  6. ClutchCityReturns

    Joined:
    Apr 26, 2005
    Messages:
    13,698
    Likes Received:
    3,355
    I'm actually impressed. 5 posts in and no Geico caveman references.
     
  7. gbritton

    gbritton Member

    Joined:
    Jul 12, 2004
    Messages:
    297
    Likes Received:
    0
    ATTAAAAGCGTTTTAGCGCGCAGTCAGTAATAGTGTGCTAGAG
     
  8. WhoMikeJames

    WhoMikeJames Member

    Joined:
    Jun 28, 2005
    Messages:
    12,691
    Likes Received:
    307
    Sorry i had to post this.

    [​IMG]

    Heres the right guy.

    [​IMG]
     
  9. weakfromtoday

    weakfromtoday Member
    Supporting Member

    Joined:
    Dec 5, 2002
    Messages:
    3,703
    Likes Received:
    2,354
    Shuuuusshhh! This story is old news. I've already seen the documentary.

    [​IMG]
     
  10. mateo

    mateo Member

    Joined:
    Jun 20, 2001
    Messages:
    5,975
    Likes Received:
    300
    Carl Everett wants you to know that there are no Neanderthals in the Bible.
     
  11. rimrocker

    rimrocker Member

    Joined:
    Dec 22, 1999
    Messages:
    24,534
    Likes Received:
    13,782
    Oh come on... there's one obvious reference here... you people have to do better than this...
     
  12. Zboy

    Zboy Member

    Joined:
    Aug 19, 2002
    Messages:
    27,234
    Likes Received:
    21,959
    [​IMG]


    "Yeah sure. I see how it is. It's such an unanticipated feat. It could tell us what I must look like or my bad...what i SHOULD have looked like 1000s of years ago.

    Wonder what skin and hair color I had *back* then. The mystery to my ..Oh!Sorry again, *their*RELATIVE facility with language revealed.

    Cant wait to clear up what sort of relationship existed between them and the first modern humans. Let's completely ignore the relationship that exists today. But I can see how easy it is to overlook that.

    And did I hear mention of interbreeding?! Yeah, I am sure Sam Cassel, Chris Kaman, and my cousin Dirk Nowitzki were products of miraculous births.

    Maybe next time you should do a little research."

    Geico Caveman
    Chief Genetic Engineer
    Biolabs.
     
    #12 Zboy, Nov 16, 2006
    Last edited: Nov 16, 2006
  13. rimrocker

    rimrocker Member

    Joined:
    Dec 22, 1999
    Messages:
    24,534
    Likes Received:
    13,782
    This is what I was looking for...

    [​IMG]

    "Your world scares me!"
     
  14. francis 4 prez

    Joined:
    Aug 15, 2001
    Messages:
    22,025
    Likes Received:
    4,552

    awesome.
     
  15. jgreen91

    jgreen91 Member

    Joined:
    Oct 15, 2002
    Messages:
    2,496
    Likes Received:
    46
    I'm not 100% in love with your tone right now.
     
  16. univac hal

    univac hal Member

    Joined:
    Nov 10, 2002
    Messages:
    671
    Likes Received:
    29
    Yeah, because science should really grind to a halt. It just hurts people's feelings. Plus it hasn't done anything for the human race at all. What a waste of time and money
     
  17. MadMax

    MadMax Member

    Joined:
    Sep 19, 1999
    Messages:
    78,372
    Likes Received:
    29,270
    dude...he's joking. it's a line from a geico ad. i'm sure he thinks science is totally rad.
     
  18. Master Baiter

    Master Baiter Member

    Joined:
    Jul 6, 2001
    Messages:
    9,608
    Likes Received:
    1,377
    Your ignorance is amusing to me :D
     
  19. univac hal

    univac hal Member

    Joined:
    Nov 10, 2002
    Messages:
    671
    Likes Received:
    29
    You guys really need to provide some warning signal of sorts for foreigners such as myself.. along the lines of "JOKE: American culture required" or something :D

    My apologies to jgreen91 :eek:
     
  20. MadMax

    MadMax Member

    Joined:
    Sep 19, 1999
    Messages:
    78,372
    Likes Received:
    29,270
    where are you from??
     

Share This Page

  • About ClutchFans

    Since 1996, ClutchFans has been loud and proud covering the Houston Rockets, helping set an industry standard for team fan sites. The forums have been a home for Houston sports fans as well as basketball fanatics around the globe.

  • Support ClutchFans!

    If you find that ClutchFans is a valuable resource for you, please consider becoming a Supporting Member. Supporting Members can upload photos and attachments directly to their posts, customize their user title and more. Gold Supporters see zero ads!


    Upgrade Now